Stem-loop sequence ccr-mir-21

AccessionMI0023368 (change log)
DescriptionCyprinus carpio miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

4 open access papers mention ccr-mir-21
(20 sentences)

Stem-loop
   --u    uucug             c            g     a 
5'    ccca     ucagguagcuuau agacugguguug cugua g
      ||||     ||||||||||||| |||||||||||| ||||| u
3'    gggu     aguccgucggaua ucugacuacaac gguau c
   uuc    uuuaa             a            -     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-21

Accession MIMAT0026267
Sequence

16 - 

uagcuuaucagacugguguuggc

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).