Stem-loop sequence ccr-mir-206

AccessionMI0023366 (change log)
DescriptionCyprinus carpio miR-206 stem-loop
Gene family MIPF0000038; mir-1
Literature search

2 open access papers mention ccr-mir-206
(9 sentences)

Stem-loop
   uugc  -        g                cc     uacg ua 
5'     uc uuugagau acauacuuccuuauau  ccaua    g  a
       || |||||||| ||||||||||||||||  |||||    |   
3'     ag gaacucug ugugugaaggaaugua  gguau    c  u
   ----  n        g                -a     cuaa ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-206

Accession MIMAT0026264
Sequence

57 - 

uggaauguaaggaagugugugg

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).