Stem-loop sequence ccr-mir-203b

AccessionMI0023364 (change log)
DescriptionCyprinus carpio miR-203b stem-loop
Gene family MIPF0000108; mir-203
Literature search

1 open access papers mention ccr-mir-203b
(1 sentences)

Stem-loop
   ggcu   -  -    gc           u    g    a     cuu 
5'     ucc uc uuug  cgagugguucu aaca uuca caguu   u
       ||| || ||||  ||||||||||| |||| |||| |||||    
3'     agg ag agac  guucaccagga uugu aagu guuaa   u
   ---a   u  c    ua           c    a    -     aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-203b-5p

Accession MIMAT0026261
Sequence

18 - 

agugguucuuaacaguucaacag

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ccr-miR-203b-3p

Accession MIMAT0026262
Sequence

55 - 

gugaaauguucaggaccacuug

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).