Stem-loop sequence ccr-mir-203a

AccessionMI0023363 (change log)
DescriptionCyprinus carpio miR-203a stem-loop
Gene family MIPF0000108; mir-203
Literature search

1 open access papers mention ccr-mir-203a
(1 sentences)

Stem-loop
   ucu     --          gc         u    g    a     cua 
5'    ucugg  ucucucuggu  agugguucu aaca uuca caguu   u
      |||||  ||||||||||  ||||||||| |||| |||| |||||   c
3'    agauc  agagggacua  ucaccagga uugu aagu guuaa   u
   --a     au          gu         u    a    -     aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-203a

Accession MIMAT0026260
Sequence

59 - 

gugaaauguuuaggaccacuug

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).