Stem-loop sequence ccr-mir-200b

AccessionMI0023362 (change log)
DescriptionCyprinus carpio miR-200b stem-loop
Gene family MIPF0000019; mir-8
Literature search

1 open access papers mention ccr-mir-200b
(4 sentences)

Stem-loop
   -   gu    u  uc    -    g      c      uuuca 
5'  ugg  aguc uc  cauc uuac aggcag auugga     u
    |||  |||| ||  |||| |||| |||||| ||||||     u
3'  acc  ucgg ag  guag aaug uccguc uaaucu     a
   c   ug    u  ua    u    g      a      cuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-200b

Accession MIMAT0026259
Sequence

52 - 

uaauacugccugguaaugauga

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).