Stem-loop sequence ccr-mir-19d

AccessionMI0023360 (change log)
DescriptionCyprinus carpio miR-19d stem-loop
Gene family MIPF0000011; mir-19
Literature search

1 open access papers mention ccr-mir-19d
(1 sentences)

Stem-loop
   --u     g   a       c      -    gg   uu    cuc  gu 
5'    ugucg gug cggucag uuugcg gggu  gca  cagc   gg  c
      ||||| ||| ||||||| |||||| ||||  |||  ||||   ||   
3'    acagc cac gucaguc aaacgu ccca  cgu  gucg   cc  a
   cgc     a   -       a      a    aa   --    ---  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-19d

Accession MIMAT0026257
Sequence

56 - 

ugugcaaacccaugcaaaacuga

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).