![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ccr-mir-196a |
|
Accession | MI0023357 (change log) |
Description | Cyprinus carpio miR-196a stem-loop |
Gene family | MIPF0000031; mir-196 |
Literature search |
2 open access papers mention ccr-mir-196a |
Stem-loop |
--uggu u a a ug c 5' gcgugguu agguaguuuc uguuguuggg u g u |||||||| |||||||||| |||||||||| | | 3' ugcauuag uccgucaaag acaacagcuc g u u cuugac u a - gu c |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence ccr-miR-196a |
|
Accession | MIMAT0026253 |
Sequence |
13 - uagguaguuucauguuguuggg - 34 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22303472
"Identification and profiling of microRNAs from skeletal muscle of the common carp"
PLoS One. 7:e30925(2012).
|