Stem-loop sequence ccr-mir-193a

AccessionMI0023355 (change log)
DescriptionCyprinus carpio miR-193a stem-loop
Gene family MIPF0000082; mir-193
Literature search

1 open access papers mention ccr-mir-193a
(1 sentences)

Stem-loop
   ---aaa  cauua   u      gg     u     cg   a  g    u   ua 
5'       ga     aug guuaga  uuggg cuuug  ggc ag ugag agu  a
         ||     ||| ||||||  ||||| |||||  ||| || |||| |||  a
3'       cu     uac cggucu  gaccc gaaac  ccg uc acuc uca  u
   cuccua  -aaug   u      uu     u     au   g  a    -   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-193a

Accession MIMAT0026251
Sequence

64 - 

aacuggccuacaaagucccagu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).