Stem-loop sequence ccr-mir-190

AccessionMI0023353 (change log)
DescriptionCyprinus carpio miR-190 stem-loop
Gene family MIPF0000076; mir-190
Literature search

1 open access papers mention ccr-mir-190
(1 sentences)

Stem-loop
   ----ac     ag cuuucu       u    -uu                ua     uuau 
5'       cugga  c      gcagggc cugu   gauauguuugauauau  gguug    u
         |||||  |      ||||||| ||||   ||||||||||||||||  |||||     
3'       gaccu  g      cguccug gaca   uuauacaaacuauaua  ucaac    c
   uguuca     cu ---ucu       u    ucc                --     cugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-190

Accession MIMAT0026249
Sequence

30 - 

ugauauguuugauauauuagg

 - 50

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).