Stem-loop sequence ccr-mir-184

AccessionMI0023348 (change log)
DescriptionCyprinus carpio miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

2 open access papers mention ccr-mir-184
(12 sentences)

Stem-loop
       a        -auuca    ac     c         c      a c     uauccau 
5' ggug gacuagga      gucg  cacau uccuuauca uuuucc g ccagc       u
   |||| ||||||||      ||||  ||||| ||||||||| |||||| | |||||        
3' cuac cugguccu      uagc  gugua gggaauagu aagagg c gguug       u
       -        cccuca    cc     c         c      - a     ccuauga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-184

Accession MIMAT0026244
Sequence

73 - 

uggacggagaacugauaagggc

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).