Stem-loop sequence ccr-mir-15b

AccessionMI0023338 (change log)
DescriptionCyprinus carpio miR-15b stem-loop
Gene family MIPF0000006; mir-15
Literature search

2 open access papers mention ccr-mir-15b
(2 sentences)

Stem-loop
   -----     a  g   u  ag                 u  ---   c 
5'      cccag gu ccc gu  cagcacaucaugguuug aa   guu u
        ||||| || ||| ||  ||||||||||||||||| ||   ||| a
3'      ggguc cg ggg ca  gucguguaguauuaaac uu   cgg a
   uuuga     -  a   u  cu                 c  aaa   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-15b

Accession MIMAT0026232
Sequence

15 - 

uagcagcacaucaugguuugu

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).