Stem-loop sequence ccr-mir-15a-2

AccessionMI0023337 (change log)
DescriptionCyprinus carpio miR-15a-2 stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention ccr-mir-15a-2
(1 sentences)

Stem-loop
        uga      a        ga          gugau 
5' cuagg   uggugu gcagcaca  augguuugug     a
   |||||   |||||| ||||||||  ||||||||||      
3' ggucc   acuacg cgucgugu  ugccggacgu     c
        uua      a        ag          agaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-15a

Accession MIMAT0026228
Sequence

14 - 

uagcagcacagaaugguuugu

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).