Stem-loop sequence ccr-mir-153b

AccessionMI0023334 (change log)
DescriptionCyprinus carpio miR-153b stem-loop
Gene family MIPF0000050; mir-153
Literature search

1 open access papers mention ccr-mir-153b
(1 sentences)

Stem-loop 
   aguauug    g         -           gu -       a uagu 
5'        caca cugucugug ucauuuuugug  u ugcagcu g    c
          |||| ||||||||| |||||||||||  | ||||||| |     
3'        gugu gacagacac aguaaaaacac  a acguuga c    u
   -------    g         g           ug u       c uugg
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-153b

Accession MIMAT0026229
Sequence

59 -  

uugcauagucacaaaaaugagc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).