Stem-loop sequence ccr-mir-148

AccessionMI0023332 (change log)
DescriptionCyprinus carpio miR-148 stem-loop
Gene family MIPF0000056; mir-148
Literature search

2 open access papers mention ccr-mir-148
(3 sentences)

Stem-loop
   ag              a    cc    c   u 
5'   uaaaguucugugau cacu  gacu uaa u
     |||||||||||||| ||||  |||| |||  
3'   guuucaagacauua guga  cuga guu g
   uu              c    --    c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-148

Accession MIMAT0026227
Sequence

42 - 

ucagugcauuacagaacuuugu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).