Stem-loop sequence ccr-mir-144

AccessionMI0023330 (change log)
DescriptionCyprinus carpio miR-144 stem-loop
Gene family MIPF0000093; mir-144
Literature search

1 open access papers mention ccr-mir-144
(1 sentences)

Stem-loop
   -cg  c   -      a  c  g        g         --ag    u 
5'    gu uug uccucu ga ag auaucauc uauacugua    uuca u
      || ||| |||||| || || |||||||| |||||||||    ||||  
3'    ca aac ggggga cu uc uguaguag auaugacau    gagu a
   cca  u   u      c  a  a        -         caca    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-144

Accession MIMAT0026225
Sequence

57 - 

cuacaguauagaugauguacu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).