Stem-loop sequence ccr-mir-142-2

AccessionMI0023328 (change log)
DescriptionCyprinus carpio miR-142-2 stem-loop
Gene family MIPF0000084; mir-142
Literature search

1 open access papers mention ccr-mir-142-2
(1 sentences)

Stem-loop
   gaagagaagaggcgggaacaucagugcag   cu          ac        uaaag  c 
5'                              uca  cauaaaguag  agcacuac     gu u
                                |||  ||||||||||  ||||||||     ||  
3'                              agu  guauuucauc  uugugaug     ca c
   -----------------------------   ag          cu        ugaca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-142-5p

Accession MIMAT0026222
Sequence

35 - 

cauaaaguagacagcacuacu

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).