Stem-loop sequence ccr-mir-140

AccessionMI0023326 (change log)
DescriptionCyprinus carpio miR-140 stem-loop
Gene family MIPF0000085; mir-140
Literature search

1 open access papers mention ccr-mir-140
(1 sentences)

Stem-loop
   gu    -u ug   u   a             a       uu   uc 
5'   cucc  g  ucc guc gugguuuuacccu ugguagg  acg  a
     ||||  |  ||| ||| ||||||||||||| |||||||  |||   
3'   gagg  u  agg cag caccaagauggga accaucu  ugu  u
   --    uc gu   c   g             c       --   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-140-5p

Accession MIMAT0026220
Sequence

17 - 

cagugguuuuacccuaugguag

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ccr-miR-140-3p

Accession MIMAT0026221
Sequence

56 - 

uaccacaggguagaaccacgga

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).