Stem-loop sequence ccr-mir-139

AccessionMI0023325 (change log)
DescriptionCyprinus carpio miR-139 stem-loop
Gene family MIPF0000117; mir-139
Literature search

1 open access papers mention ccr-mir-139
(1 sentences)

Stem-loop
   -ugua   ug ----         -      -      a   g        -   u 
5'      guu  g    ucuggcugu auucua cagugc ugu ucuccagu guu c
        |||  |    ||||||||| |||||| |||||| ||| |||||||| ||| u
3'      caa  c    agaccgaca uaaggu gucgcg acg agggguca cgg a
   agcca   gu ucca         a      u      -   g        g   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-139

Accession MIMAT0026219
Sequence

22 - 

ucuacagugcaugugucuccagu

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).