Stem-loop sequence ccr-mir-138

AccessionMI0023324 (change log)
DescriptionCyprinus carpio miR-138 stem-loop
Gene family MIPF0000075; mir-138
Literature search

1 open access papers mention ccr-mir-138
(4 sentences)

Stem-loop
         u    ug ag             uca     --a    a ac 
5' ggugug gugc  c  cugguguugugaa   ggccg   uguc c  g
   |||||| ||||  |  |||||||||||||   |||||   |||| |   
3' ccacac cacg  g  gaccacaacacuu   ucggc   auag g  u
         -    gu -g             -ua     cca    c cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-138

Accession MIMAT0026218
Sequence

15 - 

agcugguguugugaaucaggc

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).