Stem-loop sequence ccr-mir-135c

AccessionMI0023322 (change log)
DescriptionCyprinus carpio miR-135c stem-loop
Gene family MIPF0000028; mir-135
Literature search

1 open access papers mention ccr-mir-135c
(3 sentences)

Stem-loop
   cuugg     g     uu u        cuau           -uuu u 
5'      ucacu cugug  u auggcuuu    uccuaugugau    c u
        ||||| |||||  | ||||||||    |||||||||||    |  
3'      gguga gacau  g uaccgaaa    gggauacacug    g c
   --gaa     -     gg u        -cuu           uacu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-135c

Accession MIMAT0026216
Sequence

20 - 

uauggcuuucuauuccuauguga

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).