Stem-loop sequence ccr-mir-133a

AccessionMI0023321 (change log)
DescriptionCyprinus carpio miR-133a stem-loop
Gene family MIPF0000029; mir-133
Literature search

3 open access papers mention ccr-mir-133a
(12 sentences)

Stem-loop
   -ca   u  uuu    a       aa  u  a        accuc 
5'    caa gc   gcua agcuggu  aa gg accaaauc     u
      ||| ||   |||| |||||||  || || ||||||||      
3'    guu cg   cgau ucgacca  uu cc ugguuuag     u
   gua   u  uau    g       ac  c  c        guaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-133a-5p

Accession MIMAT0026214
Sequence

17 - 

agcugguaaaauggaaccaaa

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ccr-miR-133a-3p

Accession MIMAT0026215
Sequence

55 - 

uugguccccuucaaccagcugu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).