Stem-loop sequence ccr-mir-132a

AccessionMI0023320 (change log)
DescriptionCyprinus carpio miR-132a stem-loop
Gene family MIPF0000065; mir-132
Literature search

1 open access papers mention ccr-mir-132a
(2 sentences)

Stem-loop
   cuug        a             au            ----  a  a 
5'     cugucucc uggugaccguggc  uagauuguuacu    gu gc a
       |||||||| |||||||||||||  ||||||||||||    || ||  
3'     gacggggg aucgcugguaccg  aucugacaaugg    ca cg c
   ----        -             ac            ucuu  -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-132a

Accession MIMAT0026213
Sequence

60 - 

uaacagucuacagccauggucg

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).