Stem-loop sequence ccr-mir-130c

AccessionMI0023319 (change log)
DescriptionCyprinus carpio miR-130c stem-loop
Gene family MIPF0000034; mir-130
Literature search

1 open access papers mention ccr-mir-130c
(2 sentences)

Stem-loop 
   uacug      u    g        uc      acu     g  gu 
5'      uuguug ccag gcccuuuu  uguugu   acugu ca  c
        |||||| |||| ||||||||  ||||||   ||||| ||   
3'      aacagu gguu cgggaaaa  auaacg   ugacg gu  a
   -----      c    a        uu      ---     a  ag
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-130c

Accession MIMAT0026212
Sequence

55 -  

cagugcaauauuaaaagggcau

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).