Stem-loop sequence ccr-mir-130a

AccessionMI0023317 (change log)
DescriptionCyprinus carpio miR-130a stem-loop
Gene family MIPF0000034; mir-130
Literature search

1 open access papers mention ccr-mir-130a
(2 sentences)

Stem-loop
   gu   u         c   u          a  --        
5'   cug ccagugccc uuu auauuguacu cu  gauaacc 
     ||| ||||||||| ||| |||||||||| ||  |||||| c
3'   gac gguuacggg aaa uguaacguga ga  uuauuga 
   -g   c         a   u          c  ua        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-130a

Accession MIMAT0026210
Sequence

53 - 

cagugcaauguuaaaagggcau

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).