Stem-loop sequence ccr-mir-128

AccessionMI0023315 (change log)
DescriptionCyprinus carpio miR-128 stem-loop
Gene family MIPF0000048; mir-128
Literature search

1 open access papers mention ccr-mir-128
(1 sentences)

Stem-loop
   --g   c       uuc       agg      cu   a  c 
5'    gag ggcugga   ggggccg   cacugu  gag cg c
      ||| |||||||   |||||||   ||||||  ||| || c
3'    cuc ccgaccu   cucuggc   gugaca  cuu gc u
   uca   c       uuu       caa      cu   a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-128

Accession MIMAT0026208
Sequence

51 - 

ucacagugaaccggucucuuu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).