Stem-loop sequence ccr-mir-126

AccessionMI0023314 (change log)
DescriptionCyprinus carpio miR-126 stem-loop
Gene family MIPF0000115; mir-126
Literature search

1 open access papers mention ccr-mir-126
(1 sentences)

Stem-loop
   uuau    uu      c           u       c --cu  gc 
5'     cugc  cacagu cauuauuacuu ugguacg g    ag  c
       ||||  |||||| ||||||||||| ||||||| |    ||   
3'     gacg  guguca guaauaaugag gccaugc c    uc  a
   ----    --      c           u       u aaac  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-126-5p

Accession MIMAT0026206
Sequence

18 - 

cauuauuacuuuugguacgcg

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ccr-miR-126-3p

Accession MIMAT0026207
Sequence

55 - 

cucguaccgugaguaauaaugc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).