Stem-loop sequence ccr-mir-125b

AccessionMI0023312 (change log)
DescriptionCyprinus carpio miR-125b stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention ccr-mir-125b
(4 sentences)

Stem-loop 
         u    c c          gc   gu 
5' gguccc gaga c uaacuuguga  uuu  g
   |||||| |||| | ||||||||||  |||  u
3' ccaggg uucu g auuggacacu  aag  g
         -    c a          aa   uc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-125b

Accession MIMAT0026204
Sequence

3 -  

ucccugagacccuaacuuguga

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).