![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ccr-mir-125b |
|
Accession | MI0023312 (change log) |
Description | Cyprinus carpio miR-125b stem-loop |
Gene family | MIPF0000033; mir-10 |
Literature search |
2 open access papers mention ccr-mir-125b |
Stem-loop |
u c c gc gu 5' gguccc gaga c uaacuuguga uuu g |||||| |||| | |||||||||| ||| u 3' ccaggg uucu g auuggacacu aag g - c a aa uc |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence ccr-miR-125b |
|
Accession | MIMAT0026204 |
Sequence |
3 - ucccugagacccuaacuuguga - 24 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22303472
"Identification and profiling of microRNAs from skeletal muscle of the common carp"
PLoS One. 7:e30925(2012).
|