![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ccr-mir-10d |
|
Accession | MI0023310 (change log) |
Description | Cyprinus carpio miR-10d stem-loop |
Gene family | MIPF0000033; mir-10 |
Literature search |
2 open access papers mention ccr-mir-10d |
Stem-loop |
cucuuuguuc a g g uuuaca 5' cgucgucuauauau cccu uagaaccgaau ugug c |||||||||||||| |||| ||||||||||| |||| a 3' guagcagguauaug gggg auuuuggcuua acac g ------aaac a - g uuacac |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence ccr-miR-10d |
|
Accession | MIMAT0026202 |
Sequence |
24 - uacccuguagaaccgaaugugu - 45 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22303472
"Identification and profiling of microRNAs from skeletal muscle of the common carp"
PLoS One. 7:e30925(2012).
|