Stem-loop sequence ccr-mir-10b

AccessionMI0023308 (change log)
DescriptionCyprinus carpio miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention ccr-mir-10b
(6 sentences)

Stem-loop
   aaa   cugucagua         a   ac        ac  a       uccaaaa 
5'    ggc         gucgucuau ugu  ccuguaga  cg auuugug       c
      |||         ||||||||| |||  ||||||||  || |||||||        
3'    ccg         cagcgggua aua  ggacaucu  gc uaaacgc       a
   gca   ---aaaaug         c   -a        cu  a       uaaaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-10b

Accession MIMAT0026200
Sequence

28 - 

uacccuguagaaccgaauuugu

 - 49

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).