Stem-loop sequence ccr-mir-101b

AccessionMI0023305 (change log)
DescriptionCyprinus carpio miR-101b stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention ccr-mir-101b
(2 sentences)

Stem-loop
   uu   c                    cg     g  ug 
5'   guc auuuucaguuaucaugguac  gugcu ug  c
     ||| ||||||||||||||||||||  ||||| ||  c
3'   cag uagaagucaauaguaucaug  cauga ac  u
   --   u                    -a     -  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-101b

Accession MIMAT0026197
Sequence

47 - 

guacaguacuaugauaacuga

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).