![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ccr-mir-101b |
|
Accession | MI0023305 (change log) |
Description | Cyprinus carpio miR-101b stem-loop |
Gene family | MIPF0000046; mir-101 |
Literature search |
1 open access papers mention ccr-mir-101b |
Stem-loop |
uu c cg g ug 5' guc auuuucaguuaucaugguac gugcu ug c ||| |||||||||||||||||||| ||||| || c 3' cag uagaagucaauaguaucaug cauga ac u -- u -a - ug |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence ccr-miR-101b |
|
Accession | MIMAT0026197 |
Sequence |
47 - guacaguacuaugauaacuga - 67 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22303472
"Identification and profiling of microRNAs from skeletal muscle of the common carp"
PLoS One. 7:e30925(2012).
|