Stem-loop sequence ccr-mir-101a

AccessionMI0023304 (change log)
DescriptionCyprinus carpio miR-101a stem-loop
Gene family MIPF0000046; mir-101
Literature search

2 open access papers mention ccr-mir-101a
(7 sentences)

Stem-loop
      u   c gg                   a    gucca 
5' ggc gcc u  uucaguuaucacagugcug ugcu     u
   ||| ||| |  ||||||||||||||||||| ||||      
3' ccg cgg a  aagucaauagugucaugac augg     c
      u   u gg                   -    aaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-101a

Accession MIMAT0026196
Sequence

50 - 

uacaguacugugauaacugaag

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).