Stem-loop sequence ccr-mir-100

AccessionMI0023303 (change log)
DescriptionCyprinus carpio miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention ccr-mir-100
(2 sentences)

Stem-loop
   ccu   -   u    c a   cg     c   a      g  ac 
5'    gcc ugc gaca a acc  uagau cga cuugug ug  u
      ||| ||| |||| | |||  ||||| ||| |||||| ||   
3'    cgg gug cugu u ugg  aucua guu gaacac ac  g
   --a   u   u    c a   au     u   c      -  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-100

Accession MIMAT0026195
Sequence

17 - 

aacccguagauccgaacuugu

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).