Stem-loop sequence hsa-mir-7107

Accession

MI0022958 (change log)

Symbol

HGNC:MIR7107

Description

Homo sapiens miR-7107 stem-loop

Literature search

2 open access papers mention hsa-mir-7107
(13 sentences)

Stem-loop

   ugcc  c    u      -     a     a u    ag u 
5'     gu ggcc ggggag gagga gggca g ccaa  g a
       || |||| |||||| ||||| ||||| | ||||  |  
3'     ca ccgg uuuuuc cucuu cuugu c gguu  c u
   -gaa  u    -      u     a     - u    ga a 

Deep sequencing

45 reads, 13.8 reads per million, 29 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr12: 121444273-121444352 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000402518 ; C12orf43-011; exon 1

  OTTHUMT00000402521 ; C12orf43-003; intron 2

  OTTHUMT00000402523 ; C12orf43-008; intron 2

  OTTHUMT00000402517 ; C12orf43-001; intron 3

  OTTHUMT00000402519 ; C12orf43-002; intron 3

  OTTHUMT00000402520 ; C12orf43-009; intron 3

  OTTHUMT00000402522 ; C12orf43-005; intron 3

  OTTHUMT00000402524 ; C12orf43-006; intron 3

  OTTHUMT00000402525 ; C12orf43-007; intron 3

  OTTHUMT00000402526 ; C12orf43-010; intron 3

  ENST00000502891 ; C12orf43-011; exon 1

  ENST00000546272 ; C12orf43-003; intron 2

  ENST00000538296 ; C12orf43-008; intron 2

  ENST00000445832 ; C12orf43-001; intron 3

  ENST00000537817 ; C12orf43-002; intron 3

  ENST00000536407 ; C12orf43-009; intron 3

  ENST00000539736 ; C12orf43-005; intron 3

  ENST00000535367 ; C12orf43-006; intron 3

  ENST00000539088 ; C12orf43-007; intron 3

  ENST00000508193 ; C12orf43-010; intron 3

  ENST00000288757 ; C12orf43-201; intron 3

  ENST00000366211 ; C12orf43-202; intron 4

Database links

• HGNC:MIR7107
• miRBase Tracker:MI0022958

Mature sequence hsa-miR-7107-5p

• Accession: MIMAT0028111
• Sequence: 6 - ucggccuggggaggaggaaggg - 27
• Deep sequencing: 27 reads, 20 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-7107-5p
  • miRDB:hsa-miR-7107-5p

Mature sequence hsa-miR-7107-3p

• Accession: MIMAT0028112
• Sequence: 48 - uggucuguucauucucucuuuuuggcc - 74
• Deep sequencing: 15 reads, 10 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-7107-3p
  • miRDB:hsa-miR-7107-3p

References

1. PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).