Stem-loop sequence hsa-mir-6861

Accession

MI0022708 (change log)

Symbol

HGNC:MIR6861

Description

Homo sapiens miR-6861 stem-loop

Literature search

1 open access papers mention hsa-mir-6861
(1 sentences)

Stem-loop

   --- a   a     u   u    c      gcuc 
5'    g ggc cuggg agg gggg uccagg    c
      | ||| ||||| ||| |||| ||||||     
3'    c ccg gaccc ucc cucc aggucc    u
   aca -   -     c   u    -      acag 

Deep sequencing

83 reads, 6.98 reads per million, 43 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr12: 112163258-112163321 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000368316 ; ACAD10-010; intron 1

  OTTHUMT00000404999 ; ACAD10-007; intron 3

  OTTHUMT00000368320 ; ACAD10-014; intron 3

  OTTHUMT00000368318 ; ACAD10-012; intron 3

  OTTHUMT00000368310 ; ACAD10-004; intron 3

  OTTHUMT00000368319 ; ACAD10-013; intron 4

  OTTHUMT00000368321 ; ACAD10-015; intron 8

  OTTHUMT00000404997 ; ACAD10-018; intron 8

  OTTHUMT00000368307 ; ACAD10-001; intron 8

  OTTHUMT00000368308 ; ACAD10-002; intron 9

  ENST00000515283 ; ACAD10-010; intron 1

  ENST00000552706 ; ACAD10-007; intron 3

  ENST00000507683 ; ACAD10-014; intron 3

  ENST00000503490 ; ACAD10-012; intron 3

  ENST00000508303 ; ACAD10-004; intron 3

  ENST00000502746 ; ACAD10-013; intron 4

  ENST00000413681 ; ACAD10-015; intron 8

  ENST00000549590 ; ACAD10-018; intron 8

  ENST00000313698 ; ACAD10-001; intron 8

  ENST00000392636 ; ACAD10-201; intron 8

  ENST00000455480 ; ACAD10-002; intron 9

Database links

• HGNC:MIR6861
• miRBase Tracker:MI0022708

Mature sequence hsa-miR-6861-5p

• Accession: MIMAT0027623
• Sequence: 6 - acuggguagguggggcuccagg - 27
• Deep sequencing: 20 reads, 17 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6861-5p
  • miRDB:hsa-miR-6861-5p

Mature sequence hsa-miR-6861-3p

• Accession: MIMAT0027624
• Sequence: 40 - uggaccucuccuccccag - 57
• Deep sequencing: 51 reads, 32 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6861-3p
  • miRDB:hsa-miR-6861-3p

References

1. PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).