Stem-loop sequence hsa-mir-6777

Accession

MI0022622 (change log)

Symbol

HGNC:MIR6777

Description

Homo sapiens miR-6777 stem-loop

Literature search

2 open access papers mention hsa-mir-6777
(2 sentences)

Stem-loop

   ucaagac    a      -c     u  agau  a 
5'        gggg gucagg  agugg gg    gg g
          |||| ||||||  ||||| ||    || a
3'        cccc cggucc  ucacc cc    cc g
   -----ga    -      uc     u  gagu  c 

Deep sequencing

324 reads, 0 reads per million, 75 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr17: 17813480-17813545 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000131929 ; TOM1L2-002; intron 1

  OTTHUMT00000131928 ; TOM1L2-001; intron 1

  OTTHUMT00000443246 ; TOM1L2-010; intron 1

  OTTHUMT00000131931 ; TOM1L2-004; intron 1

  OTTHUMT00000443248 ; TOM1L2-007; intron 1

  OTTHUMT00000443249 ; TOM1L2-009; intron 1

  OTTHUMT00000443250 ; TOM1L2-008; intron 1

  OTTHUMT00000443252 ; TOM1L2-011; intron 1

  OTTHUMT00000443253 ; TOM1L2-012; intron 1

  ENST00000581396 ; TOM1L2-002; intron 1

  ENST00000379504 ; TOM1L2-001; intron 1

  ENST00000318094 ; TOM1L2-010; intron 1

  ENST00000395739 ; TOM1L2-004; intron 1

  ENST00000535933 ; TOM1L2-007; intron 1

  ENST00000540946 ; TOM1L2-009; intron 1

  ENST00000542206 ; TOM1L2-008; intron 1

  ENST00000537091 ; TOM1L2-011; intron 1

  ENST00000579586 ; TOM1L2-012; intron 1

Clustered miRNAs

< 10kb from hsa-mir-6777

• hsa-mir-33b: chr17: 17813836-17813931 [-]
• hsa-mir-6777: chr17: 17813480-17813545 [-]

Database links

• HGNC:MIR6777
• miRBase Tracker:MI0022622

Mature sequence hsa-miR-6777-5p

• Accession: MIMAT0027454
• Sequence: 6 - acggggagucaggcaguggugga - 28
• Deep sequencing: 235 reads, 54 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6777-5p
  • miRDB:hsa-miR-6777-5p

Mature sequence hsa-miR-6777-3p

• Accession: MIMAT0027455
• Sequence: 47 - uccacucuccuggcccccag - 66
• Deep sequencing: 30 reads, 15 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6777-3p
  • miRDB:hsa-miR-6777-3p

References

1. PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).