Stem-loop sequence hsa-mir-6756

AccessionMI0022601 (change log)
Symbol HGNC:MIR6756
DescriptionHomo sapiens miR-6756 stem-loop
Literature search

2 open access papers mention hsa-mir-6756
(5 sentences)

Stem-loop 
   acccua   ug   cu     u    cu       
5'       ggg  ggg  ggagg gggg  gaggcu 
         |||  |||  ||||| ||||  ||||| g
3'       ccc  ccc  ccuuc cccu  uucuga 
   ----ga   gu   -u     -    cc
Get sequence
Deep sequencing
196 reads, 21.4 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 119312950-119313012 [-]
antisense
OTTHUMT00000388222 ; RP11-305N23.1-001; intron 2
OTTHUMT00000388223 ; RP11-305N23.1-002; intron 2
OTTHUMT00000447243 ; RP11-305N23.1-005; intron 2
OTTHUMT00000388224 ; RP11-305N23.1-003; intron 2
ENST00000498979 ; USP2-AS1-001; intron 2
ENST00000500970 ; USP2-AS1-002; intron 2
ENST00000578923 ; USP2-AS1-005; intron 2
ENST00000530002 ; USP2-AS1-003; intron 2
Database links

Mature sequence hsa-miR-6756-5p

Accession MIMAT0027412
Sequence

6 -  

aggguggggcuggagguggggcu

 - 28

Get sequence
Deep sequencing44 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6756-3p

Accession MIMAT0027413
Sequence

44 -  

uccccuuccucccugcccag

 - 63

Get sequence
Deep sequencing58 reads, 33 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).