Dead miRNA entry

miRNA accession:
MI0022558
miRNA ID:
hsa-mir-6723
Comment:
The pattern of reads from RNAseq experiments does not support the annotation of mir-6723 as a miRNA. The sequence is removed from the database in release 22.

Previous miRNA entry

Stem-loop sequence hsa-mir-6723

AccessionMI0022558 (change log)
Symbol HGNC:MIR6723
DescriptionHomo sapiens miR-6723 stem-loop
Stem-loop
   aug      -gau    cg g aa --g   g     --  -   a 
5'    caucgg    aguc  a u  c   ucg ggcau  uc cgg u
      ||||||    ||||  | |  |   ||| |||||  || ||| a
3'    guagcc    uuag  u a  g   ggu uugug  ag gcc g
   uaa      gcau    au g aa aag   g     aa  a   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-6723-5p

Accession MIMAT0025855
Sequence

11 - 

auaguccgaguaacgucggggc

 - 32

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).