Stem-loop sequence gga-mir-6631

AccessionMI0022450 (change log)
DescriptionGallus gallus miR-6631 stem-loop
Literature search

1 open access papers mention gga-mir-6631
(3 sentences)

Stem-loop 
   ---------gaaa     -------        u   a     au       -u  ug uga 
5'              auuga       agagcugg ggg agaga  gcugugg  uc  c   g
                |||||       |||||||| ||| |||||  |||||||  ||  |   g
3'              ugacu       uuucgauu cuc ucucu  cgacacc  gg  g   a
   cucauuguuugua     cuacguc        u   c     cu       cc  gu ucc
Get sequence
Deep sequencing
307 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 12516662-12516771 [+]
intergenic
Database links

Mature sequence gga-miR-6631-5p

Accession MIMAT0025727
Sequence

21 -  

gaagagaaugcugugguucugc

 - 42

Get sequence
Deep sequencing86 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).