Stem-loop sequence bta-mir-2284z-5

AccessionMI0022338 (change log)
DescriptionBos taurus miR-2284z-5 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284z-5
(32 sentences)

Stem-loop 
   -          aa   a                u   aac 
5'  uuggguuggc  aaa guuuguuuggguuuuu cau   a
    ||||||||||  ||| |||||||||||||||| |||    
3'  aacccaaccg  uuu caaacaaacccaaaag gua   u
   u          ga   a                -   auu
Get sequence
Deep sequencing
10742 reads, 47.9 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 43348101-43348180 [+]
sense
ENSBTAT00000020345 ; PTPRB-201; intron 42
Database links

Mature sequence bta-miR-2284z

Accession MIMAT0025559
Sequence

11 -  

aaaaaaguuuguuuggguuuuu

 - 32

Get sequence
Deep sequencing73137 reads, 73 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).
2
PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).