Stem-loop sequence bta-mir-2284z-4

AccessionMI0022336 (change log)
DescriptionBos taurus miR-2284z-4 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284z-4
(32 sentences)

Stem-loop 
   c   g    ca        ug        u  cu   ac 
5'  ugg uugg  aaaaaguu  uuuggguu uu  gua  a
    ||| ||||  ||||||||  |||||||| ||  |||   
3'  acc aacc  uuuuucaa  aaaccuaa aa  uau  u
   a   a    ag        gu        u  ug   cc
Get sequence
Deep sequencing
10442 reads, 45.2 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 18902656-18902735 [+]
intergenic
Database links

Mature sequence bta-miR-2284z

Accession MIMAT0025559
Sequence

11 -  

aaaaaaguuuguuuggguuuuu

 - 32

Get sequence
Deep sequencing73137 reads, 73 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).
2
PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).