![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tgu-mir-367 |
|||||
Accession | MI0022172 (change log) | ||||
Description | Taeniopygia guttata miR-367 stem-loop | ||||
Gene family | MIPF0000162; mir-367 | ||||
Stem-loop |
a - a ua c uugua 5' gg cua uacuguugcuaa ugcaa ucug u || ||| |||||||||||| ||||| |||| 3' uc ggu gugguaacgauu acguu aggu a g a a uc a uaaaa |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence tgu-miR-367 |
|
Accession | MIMAT0025395 |
Sequence |
47 - aauugcacuuuagcaaugguga - 68 |
Evidence | not experimental |
References |
|
1 |
PMID:21210939
"microRNA complements in deuterostomes: origin and evolution of microRNAs"
Evol Dev. 13:15-27(2011).
|