Stem-loop sequence mja-mir-6494

AccessionMI0022071 (change log)
DescriptionMarsupenaeus japonicus miR-6494 stem-loop
Stem-loop
   gag     -gg    -       a  guaaaa    a    g 
5'    uagga   gcgc gguggug gc      ggau cggc c
      |||||   |||| ||||||| ||      |||| ||||  
3'    guucu   cgug ucaccgc cg      ucug gccg g
   ggg     agg    g       -  ---agg    -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mja-miR-6494

Accession MIMAT0025303
Sequence

8 - 

agggcgcgguggugagcgua

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1