Stem-loop sequence mja-mir-6493

AccessionMI0022070 (change log)
DescriptionMarsupenaeus japonicus miR-6493 stem-loop
Stem-loop
   agcc   uc    -a      a     -  aa 
5'     acg  cggc  gguuuu ccccu ga  g
       |||  ||||  |||||| ||||| ||  c
3'     ugc  gucg  ccaaag gggga cu  c
   -aau   ga    cg      -     a  nu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mja-miR-6493-5p

Accession MIMAT0025301
Sequence

5 - 

acguccggcagguuuuaccccu

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mja-miR-6493-3p

Accession MIMAT0025302
Sequence

39 - 

agggggaaaccgcgcugagcguua

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1