Dead miRNA entry

miRNA accession:
MI0022067
miRNA ID:
mja-mir-6490
Comment:
The sequence reported as miR-6490 appears to derive from a fragment of LSU rRNA. The entry is removed from miRBase 21.

Previous miRNA entry

Stem-loop sequence mja-mir-6490

AccessionMI0022067 (change log)
Description
Stem-loop
   ----------------------ucgaccucgaguggagggagauga    ccuaauuuaa    a   a    c    gaaaagaaa  a 
5'                                               cccg          gcau uua ucag ggag         cc a
                                                 ||||          |||| ||| |||| ||||         ||  
3'                                               gggc          cgug aau aguc ccuu         gg c
   gagcucggggggcgcuuccccugcgcuccgaagcgcgacccgagaa    --aaagccag    -   g    -    -------ag  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

References

1