Stem-loop sequence mja-mir-6489

AccessionMI0022066 (change log)
DescriptionMarsupenaeus japonicus miR-6489 stem-loop
Stem-loop
   gau      gu     ga       gga   g  -   uu  a  c   -a    c 
5'    ugaaug  cuagu  gggcacc   cug cg ccc  gg gc gcu  ccgc u
      ||||||  |||||  |||||||   ||| || |||  || || |||  ||||  
3'    auuuac  ggucg  ccugugg   ggc gc ggg  cc cg cga  ggcg c
   ---      ug     aa       aaa   a  u   cu  -  -   cg    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mja-miR-6489-5p

Accession MIMAT0025296
Sequence

20 - 

ggcaccggacuggcgcccuu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mja-miR-6489-3p

Accession MIMAT0025297
Sequence

77 - 

cgacggaaagguguccaagcugg

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1