Dead miRNA entry

miRNA accession:
MI0022046
miRNA ID:
ptc-MIR403d
Forward to:
MI0005115
Comment:
Two identical MIR403 sequences in miRBase 19 map to only one locus in the JGI v2 genome assembly. The entries are therefore merged in miRBase 20.

Previous miRNA entry

Stem-loop sequence ptc-MIR403d

AccessionMI0022046 (change log)
Description
Stem-loop
      uc  cccuaaca       u cu   u u                         cacaacc   cac 
5' ucu  uc        agaggag c  auc c gguuugugcguggaucugaggccau       guc   u
   |||  ||        ||||||| |  ||| | |||||||||||||||||||||||||       |||    
3' aga  ag        ucuccuc g  uag g ucaaacacgcacuuagauuucggua       cag   a
      ua  ccacauca       u uc   c c                         -acccac   cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).