Stem-loop sequence ptc-MIR6457a

AccessionMI0022039 (change log)
DescriptionPopulus trichocarpa miR6457a stem-loop
Gene family MIPF0001534; MIR6457
Stem-loop
          a  a ua     g  a               u ga c       a              a         u     a   u     g    a  gu  a     gaa 
5' aggaagu ag g  gaguu ga gaaauaagagaagag c  g caaacua aagaggaaacuaau uaaucucuc gcaga ugc gcaaa caac uc  cu gaucu   a
   ||||||| || |  ||||| || ||||||||||||||| |  | ||||||| |||||||||||||| ||||||||| ||||| ||| ||||| |||| ||  || |||||    
3' uccuuca uc c  uucaa cu cuuuauucucuucuc g  c guuugau uucuccuuugauua auuagaggg cgucu acg cguuu guug ag  ga cuaga   c
          g  c uc     a  c               c -a a       c              g         u     c   u     g    a  ac  a     aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000338.2: 1273447-1273673 [-]
intergenic
Database links

Mature sequence ptc-miR6457a

Accession MIMAT0025267
Sequence

68 - 

uaaucucucugcagaaugcug

 - 88

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).