Stem-loop sequence ptc-MIR6456

AccessionMI0022038 (change log)
DescriptionPopulus trichocarpa miR6456 stem-loop
Stem-loop
           g   a          a           -cuc     a 
5' aaaaauca ugc ggaucuagug aaggacucaag    gugau g
   |||||||| ||| |||||||||| |||||||||||    ||||| a
3' uuuuuagu acg ccuagauuac uuccugaguuu    uauua u
           a   c          c           cuuu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000355.2: 4638249-4638340 [-]
intergenic
Database links

Mature sequence ptc-miR6456

Accession MIMAT0025266
Sequence

59 - 

uugaguccuuccauuagaucc

 - 79

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).