Stem-loop sequence ptc-MIR6450b

AccessionMI0022033 (change log)
DescriptionPopulus trichocarpa miR6450b stem-loop
Gene family MIPF0001528; MIR6450
Stem-loop
   u   a   cca          aa              a  c   a       cgucuca  --a    g             c 
5'  guu ggu   gugucgagac  auuagccuuggguc ug guu ggaccca       ug   uccg auacuggaccuaa a
    ||| |||   ||||||||||  |||||||||||||| || ||| |||||||       ||   |||| ||||||||||||| u
3'  caa cca   cguaguucug  uaaucggaacucag ac caa ccugggu       ac   aggc ugugacuuggguu a
   a   c   aua          gg              g  a   g       uaauaca  cca    -             a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000353.2: 3927654-3927819 [+]
intergenic
Database links

Mature sequence ptc-miR6450b

Accession MIMAT0025261
Sequence

121 - 

cgaacacaggacucaaggcua

 - 141

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).