Stem-loop sequence ptc-MIR6439b

AccessionMI0022030 (change log)
DescriptionPopulus trichocarpa miR6439b stem-loop
Gene family MIPF0001526; MIR6439
Stem-loop
       c   gua  aa       a    a       c     c     ccgccc   u           cc      uuugaucgcaacgaguuuucaucugcauaugggaagauuuuca 
5' aaug uga   ag  gccaaau aaga gcagaag cauca uagcg      uaa uaaaugcucaa  cgucau                                           u
   |||| |||   ||  ||||||| |||| ||||||| ||||| |||||      ||| |||||||||||  ||||||                                           g
3' uuac acu   uc  ugguuua uucu cgucuuc guggu gucgu      auu auuuacgaguu  guagug                                           g
       a   aag  cg       g    c       a     a     ---aua   c           au      cuccaaacguuagucugaauugacuuacgaugucguaagaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000352.2: 71120-71357 [-]
intergenic
Database links

Mature sequence ptc-miR6439b

Accession MIMAT0025258
Sequence

28 - 

agcagaagccaucacuagcgc

 - 48

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).